![](https://parts.igem.org/images/partbypart/icon_composite.png)
Composite
Part:BBa_K2207014:Design
Designed by: Junming Qian Group: iGEM17_ZJU-China (2017-10-25)
PhlAC enzyme
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 4607
Illegal PstI site found at 776
Illegal PstI site found at 4619 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 776
Illegal PstI site found at 4619 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1494
Illegal XhoI site found at 2168
Illegal XhoI site found at 3079 - 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 4607
Illegal PstI site found at 776
Illegal PstI site found at 4619 - 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 4607
Illegal PstI site found at 776
Illegal PstI site found at 4619
Illegal NgoMIV site found at 1298
Illegal NgoMIV site found at 1581
Illegal NgoMIV site found at 1868
Illegal AgeI site found at 3388
Illegal AgeI site found at 3416 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 486
Illegal SapI site found at 168
Design Notes
We used the F2A sequenece(gtgaaacagactttgaattttgaccttctcaagttggcgggagacgtggagtccaaccctggacct)to link the phlA with phlC, and then combined them to eGFP to construct a fusion protein so that the two genes can be transcribed as a single mRNA and generating two independent gene products, and meanwhile we can identify whether the proteins are expressed by detecting the fluorescent.
Source
We successfully cloned the phlAC via colony PCR from Pseudomonas fluorescens 2P24, which is a gift from Prof. Liqun Zhang of China Agriculture University.
References
Jin H K, Lee S R, Li L H, et al. High Cleavage Efficiency of a 2A Peptide Derived from Porcine Teschovirus-1 in Human Cell Lines, Zebrafish and Mice[J]. Plos One, 2011, 6(4):e18556.